|
![]() |
|
|
|
![]() |
![]() |
LSXI
Home
|
Deutsch
English
|
|
![]() |
seq_dist2 (version 1.01)This program reads DNA sequences from an input file (which contains one sequence ineach line) and compares each possible pair of sequences with several distance measures. Otherwise, seq_dist2 is very similar to seq_dist. The results of the comparisons are written to standard output. You can choose whether you want all results in one big table or whether one table for each distance measure is written. See the manual for a more detailed description of this tool. Read the logfile to see what's new in this version. Download
ExampleWith input sequences like these:ttcgccctgctactaacacg agataacagcaggatttctt ggatcgcaggatctcagtca gtgaccctccttccagtccg gaattccatatcccttccaa agaccgggctccgcacctgt cttcacatacaaaattaatc gtccttcccgcggtttctac seq_dist2 produces a table like this: pair Hamming(compl.) HMeasure HMeasure(compl.) HDistance Homology(compl.) Edit(compl.) 1,1 18 10 0 0 0.5 13 1,2 19 11 13 11 0.45 13 1,3 18 13 13 13 0.35 12 1,4 19 13 9 9 0.35 13 1,5 13 13 13 13 0.35 12 1,6 16 14 11 11 0.3 15 1,7 16 14 12 12 0.3 13 1,8 16 13 10 10 0.35 13 2,1 19 11 13 11 0.45 13 2,2 14 10 0 0 0.5 10 ... or a series of different tables like these: Hamming(compl.) 1 2 3 4 5 6 7 8 1 18 19 18 19 13 16 16 16 2 19 14 18 16 16 14 16 15 3 18 18 14 18 17 11 15 15 4 19 16 18 14 17 16 16 16 5 13 16 17 17 18 17 14 17 6 16 14 11 16 17 14 19 15 7 16 16 15 16 14 19 14 16 8 16 15 15 16 17 15 16 10 HMeasure 1 2 3 4 5 6 7 8 1 10 11 13 13 13 14 14 13 2 11 10 13 12 11 13 12 12 3 13 13 12 12 13 11 14 13 4 13 12 12 14 14 13 15 13 5 13 11 13 14 12 12 12 14 6 14 13 11 13 12 12 15 11 7 14 12 14 15 12 15 12 14 8 13 12 13 13 14 11 14 10 ... last modification:
Jun/20/2008
|
||||||||||||||||||||||||||||||
Imprint
|
|
<webmaster ls11.cs.tu-dortmund.de>
|
The university does not accept liability for the contents of linked external internet sites |