|
![]() |
|
|
|
![]() |
![]() |
LSXI
Home
|
Deutsch
English
|
|
![]() |
seq_dist (version 1.01)This program reads DNA sequences from an input file (which contains one sequence ineach line) and compares each pair of consecutive sequences with several distance measures (so that if n sequences are read n/2 pairs are compared). If you want to measure the distance between all possible pairs of sequences in a pool, please use seq_dist2. The results of the comparisons are written to standard output in one table with a line for each sequence pair and a column for each distance measure. See the manual for a more detailed description of this tool. Read the logfile to see what's new in this version. Download
ExampleWith input sequences like these:ttcgccctgctactaacacg agataacagcaggatttctt ggatcgcaggatctcagtca gtgaccctccttccagtccg gaattccatatcccttccaa agaccgggctccgcacctgt cttcacatacaaaattaatc gtccttcccgcggtttctac seq_dist produces a table like this: pair Hamming(compl.) HMeasure HMeasure(compl.) HDistance Homology(compl.) Edit(compl.) 1,2 19 11 13 11 0.45 13 3,4 18 12 12 12 0.4 10 5,6 17 12 13 12 0.4 13 7,8 16 14 14 14 0.3 14 last modification:
Jun/20/2008
|
||||||||||||||||||||||||||||||
Imprint
|
|
<webmaster ls11.cs.tu-dortmund.de>
|
The university does not accept liability for the contents of linked external internet sites |