|
![]() |
|
|
|
![]() |
![]() |
LSXI
Home
|
Deutsch
English
|
|
![]() |
dsg - The DNA Sequence Generator (version 2.01)This tool generates pools of nb-unique sequences. A sequence pool is said to be nb-unique, when eachsubsequence of length nb that occurs in the pool occurs only once, and its Watson-Crick complement does not occur at all. As a consequence, self-complementary subsequences of length nb may not occur. The user can add a lot of other restrictions on the sequences' physical or chemical properties, like melting temperature, Gibbs free energy, or GC-ratio. It is also possible to restrict the choice of bases at certain positions or fix complete subsequences, or to forbid the use of user-specified subsequences. See the description of the DeLaNA input language in the manual for an enumeration of all sequence properties that can be specified by the user. See the manual for a more detailed description of this tool. Read the logfile to see what's new in this version. Download
ExampleThis DeLaNA input file:SEQUENCE oli1 { length = 10; } SEQUENCE oli2 { length = 20; GC_ratio = 0.5; } SEQUENCE oli3, oli4 { length = 15; Tm = [50;55]; } POOL mypool { n_uniqueness = 6; Na_conc = .05; sample_conc = 2e-7; Formamide_conc = 0; forbidden = "ggg"; } DESIGNTOOL { Random_Seed = 0; } produces this output: SEQUENCE oli1 { NA_type = DNA; length = 10; GC_ratio = 0.5; Tm = 25.2319; DG = -7.46638; seq_mask = "tgtgtcatcc"; } SEQUENCE oli2 { NA_type = DNA; length = 20; GC_ratio = 0.5; Tm = 54.7326; DG = -18.6712; seq_mask = "agcagtgactatgcaatggc"; } SEQUENCE oli3 { NA_type = DNA; length = 15; GC_ratio = 0.666667; Tm = 51.2528; DG = -15.4488; seq_mask = "ctgcaaaggtgcccc"; } SEQUENCE oli4 { NA_type = DNA; length = 15; GC_ratio = 0.6; Tm = 50.2349; DG = -15.2088; seq_mask = "agctatctgcacgcg"; } POOL mypool { sequences = ; n_uniqueness = 6; Hamming = 0; H_distance = 0; Homology = [0;1]; sample_conc = 2e-007; Na_conc = 0.05; formamide_conc = 0; Tm_method = NNUnified; salt_method = Unified; no_shorties = false; no_GGG = false; no_AUG = false; no_GUG = false; no_UUG = false; no_fraying = false; base_strand_GC = [0;1]; forbidden = "ggg"; } DESIGNTOOL { Random_Seed = 1174059522; ID_in_table = false; Analyze_Uniqueness = false; } last modification:
Dec/05/2007
|
||||||||||||||||||||||||||||||
Imprint
|
|
<webmaster ls11.cs.tu-dortmund.de>
|
The university does not accept liability for the contents of linked external internet sites |